A 5-year journey from a frustrating blot to identifying a self-cleavable large effector

Published in Microbiology

A 5-year journey from a frustrating blot to identifying a self-cleavable large effector
Like

Share this post

Choose a social network to share with, or copy the URL to share elsewhere

This is a representation of how your post may appear on social media. The actual post will vary between social networks

The project dates back to early 2015 when we were discovering the T6SS chaperones and their related effectors. My assistant Xiaoye came to me and showed a western blot with frustration. There wasn’t any band with the correct size but rather a strong signal at a much smaller molecular weight. The protein we were testing is a predicted T6SS effector TseI with 1545 amino acids. Cloning it was already a big hassle, and you would understand why by just taking a look at the sequence of the reverse primer we finally used to get the cloning to work "aagcatgctttttttattttcccttttctgaagccaatttttatttcaggaaaatgccctggatactgcttgta".

As an assistant professor at the time, I decided to give it a shot myself. The experiment was repeated, clones re-sequenced, and the phenotype was reproducible. So we realized the protein might be cleaved, but how?  

Bioinformatics analysis gave us the first hint. Structural prediction using Phyre2 suggested TseI is homologous to the TcC subunit of the Tc-toxin. In 2013, a Nature study by Busby et al. (2013) showed that TcC is subject to auto-proteolysis by an internal aspartic protease.  This internal protease sequence, especially the conserved catalytic residues, aligns well with a C-terminal fragment of TseI. Accordingly, mutating the conserved residues abolished the C-terminal cleavage of TseI. 

However, purified TseI has an additional protein band on an SDS-PAGE gel showing three cleavage products, N, Rhs core, and C. We then identified the cleavage sites using N-terminal sequencing and confirmed by mass spectrometry analysis. The N-terminal cleavage can be blocked by mutating either of the two conserved glutamic acid residues after the N-cleavage site. The rest of the findings are explained in detail in the paper. 

We emphasized the discovery is of broad interest partly because TseI belongs to this very large and conserved Rhs family with members found in both eukaryotic and prokaryotic domains. When we tested several TseI homologs in other bacteria, they were cleaved as well.  

What I didn't reveal in the paper is that my original interest in this protein was not just because of Rhs.  I have been interested in using the T6SS as a tool to deliver a variety of cargo proteins including the CRISPR Cas9 and wanted to know what the size limit of the cargo is. TseI at the time was the biggest effector in size. Although TseI is cleaved into three parts, we show that the non-cleaved mutant TseI is also secreted by the T6SS. Thus, T6SS in Aeromonas dhakensis is capable of secreting a cargo at least the size of TseI. I doubt 1,593 amino acid (TseI-3V5) is the limit, and given the rapid progress of the field, a new record is expected to be set by the community in no time.  As the synthetic biology field is booming, the T6SS might work as conveniently as a pickup truck to deliver all kind of cargos in the near future.

Please sign in or register for FREE

If you are a registered user on Research Communities by Springer Nature, please sign in

Go to the profile of Stephen Mensah
over 5 years ago

Great. Very insightful and informative.

Follow the Topic

Microbiology
Life Sciences > Biological Sciences > Microbiology

Related Collections

With Collections, you can get published faster and increase your visibility.

Women's Health

A selection of recent articles that highlight issues relevant to the treatment of neurological and psychiatric disorders in women.

Publishing Model: Hybrid

Deadline: Ongoing

Biosensing

With this cross-journal Collection, the editors of Communications Biology, Nature Biomedical Engineering, Nature Sensors, Nature Communications, and Scientific Reports welcome the submission of primary research Articles focusing on the development of engineered biosensing devices with the potential to be applied in biomedical research and in the management of disease conditions.

Publishing Model: Hybrid

Deadline: Jun 30, 2026