Capturing the Edge of Polymorphisms: A Reference-Free Variant Detection Method

Capturing the Edge of Polymorphisms: A Reference-Free Variant Detection Method
Like

Share this post

Choose a social network to share with, or copy the URL to share elsewhere

This is a representation of how your post may appear on social media. The actual post will vary between social networks

Explore the Research

BioMed Central
BioMed Central BioMed Central

Polymorphic edge detection (PED): two efficient methods of polymorphism detection from next-generation sequencing data - BMC Bioinformatics

Background Accurate detection of polymorphisms with a next generation sequencer data is an important element of current genetic analysis. However, there is still no detection pipeline that is completely reliable. Result We demonstrate two new detection methods of polymorphisms focusing on the Polymorphic Edge (PED). In the matching between two homologous sequences, the first mismatched base to appear is the SNP, or the edge of the structural variation. The first method is based on k-mers from short reads and detects polymorphic edges with k-mers for which there is no match between target and control, making it possible to detect SNPs by direct comparison of short-reads in two datasets (target and control) without a reference genome sequence. The second method is based on bidirectional alignment to detect polymorphic edges, not only SNPs but also insertions, deletions, inversions and translocations. Using these two methods, we succeed in making a high-quality comparison map between rice cultivars showing good match to the theoretical value of introgression, and in detecting specific large deletions across cultivars. Conclusions Using Polymorphic Edge Detection (PED), the k-mer method is able to detect SNPs by direct comparison of short-reads in two datasets without genomic alignment step, and the bidirectional alignment method is able to detect SNPs and structural variations from even single-end short-reads. The PED is an efficient tool to obtain accurate data for both SNPs and structural variations. Availability The PED software is available at: https://github.com/akiomiyao/ped .

Next-generation sequencing (NGS) has revolutionized genome analysis by enabling rapid and cost-effective acquisition of whole-genome data. However, the output consists of fragmented reads—typically ranging from 100 bases to several tens of kilobases—rather than continuous genome sequences. Variant detection is commonly performed by mapping these fragments to a reference genome, but this approach becomes infeasible when no reference is available. 

A method was developed to directly compare NGS reads from two samples, allowing for the detection of polymorphisms without constructing a reference genome. This enables direct investigation of genotype–phenotype correlations. The challenge resembles identifying mismatched pieces from two jigsaw puzzles cut from slightly different images—an endeavor long considered impractical due to the sheer volume of data. 

To simplify comparisons, each read is segmented into 20-base sequences (20-mers) by sliding one base at a time. For example: 

  • Sample A: AAATGGTACATTTATATTAT
  • Sample B: AAATGGTACATTTATATTAC 

A difference in the final base indicates a polymorphism. This approach detects not only single nucleotide polymorphisms (SNPs), but also edge of structural variants such as insertions, deletions, inversions, and translocations. While the exact nature of the mutation may not be immediately clear, its presence is evident. 

The extracted 20-mers are sorted and grouped by identical sequences, with counts displayed (Fig. 1a and b). These are then split into the first 19 bases and the final base, and the counts are aggregated per nucleotide (Fig. 1b and c). For instance, if two sequences share the same first 19 bases but differ at the final base (e.g., one ends in C and the other in T), the output will show a single row with counts for C and T respectively (Fig. 1c). 

Control and Target datasets are then compared using the same 19-mer sequences. Most sequences will have matching final bases, but polymorphic sites will show differing counts (Fig. 1d). These counts correspond to read depth, and a count of 1 is typically considered a sequencing error. If a reference genome is available, the genomic location of the 19-mer can be used to pinpoint the polymorphic edge. If not, the 19-mer itself serves as a unique identifier for the polymorphism. 

Although NGS generates massive data volumes, and extracting 20-mers by sliding one base increases the data size twentyfold, a method was established—after years of trial and error—that enables analysis on a single computer. 

In April, a bidirectional alignment method for detecting polymorphic edges was introduced. The current method also targets edge detection, and both approaches are presented in a single paper for comparative evaluation. 

By grouping individuals based on the presence or absence of a trait and obtaining sufficient sequencing data, it becomes possible to identify trait-linked polymorphisms without a reference genome. 

This reference-free variant detection method is particularly effective for non-model organisms and rapid screening scenarios. For those interested, the following publication and resources provide further details: 

Reference
Miyao, A., Kiyomiya, J.S., Iida, K. et al. Polymorphic edge detection (PED): two efficient methods of polymorphism detection from next-generation sequencing data. BMC Bioinformatics 20, 362 (2019). https://doi.org/10.1186/s12859-019-2955-6
GitHub: https://github.com/akiomiyao/ped

Follow the Topic

Comparative Genomics
Life Sciences > Biological Sciences > Biological Techniques > Genomic Analysis > Comparative Genomics
Biomedical Research
Life Sciences > Health Sciences > Biomedical Research
Agriculture
Life Sciences > Biological Sciences > Agriculture
Genome Informatics
Life Sciences > Biological Sciences > Biological Techniques > Computational and Systems Biology > Genome Informatics
Cancer Genetics and Genomics
Life Sciences > Biological Sciences > Cancer Biology > Cancer Genetics and Genomics
Genetics and Genomics
Life Sciences > Biological Sciences > Genetics and Genomics
  • BMC Bioinformatics BMC Bioinformatics

    This is an open access, peer-reviewed journal that considers articles describing novel computational algorithms and software, models and tools, including statistical methods, machine learning and artificial intelligence, as well as systems biology.

Related Collections

With Collections, you can get published faster and increase your visibility.

Extracellular vesicle research

BMC Bioinformatics is welcoming submissions to our Collection on Extracellular vesicles research.

BMC Bioinformatics is welcoming submissions to our Collection on Extracellular vesicles research. Extracellular vesicles (EVs) are are small lipid bilayer-delimited particles released by cells that play crucial roles in intercellular communication and various physiological processes. The study of EVs has gained significant attention due to their potential as biomarkers for disease diagnosis, therapeutic targets and drug delivery systems. Advanced bioinformatics tools are essential for analyzing EV data, identifying EV-associated molecules, and understanding their biological functions.

This Collection welcomes submissions on the development of new computational and/or statistical approaches for the study of extracellular vesicles. We encourage contributions that highlight innovative methods for detecting and characterizing EVs and elucidating the molecular mechanisms underlying EV biogenesis and function.

All manuscripts submitted to this journal, including those submitted to collections and special issues, are assessed in line with our editorial policies and the journal’s peer-review process. Reviewers and editors are required to declare competing interests and can be excluded from the peer review process if a competing interest exists.

Publishing Model: Open Access

Deadline: Sep 30, 2026

Bioinformatics and ecology

BMC Bioinformatics is calling for submissions to our Collection on Bioinformatics and ecology.

Ecology has become a data-heavy science. Genomic technologies and computational methods have changed what ecologists can ask and answer, and bioinformatics tools are now central to making sense of the large, messy datasets these studies produce.

This matters for some of the most pressing environmental problems we face, including climate change, habitat loss, non-indigenous species, and biodiversity crisis. Advances in DNA sequencing, comprehensive reference databases, and computational analysis now let researchers characterise microbial and macrobial communities and assess their role in ecosystem function with a level of detail that was not possible a decade ago. In conservation genomics, the same tools support practical decisions about managing endangered species and restoring habitats.

There is plenty of room for the field to develop further. As machine learning methods mature, they should improve predictions of species distributions and how ecosystems respond to environmental pressure. Better taxonomic profiling and genome assembly will also sharpen our understanding of microbial ecology and what it tells us about ecosystem health.

This Collection brings together research that pairs bioinformatics approaches with ecological questions. We are particularly interested in environmental DNA (eDNA) analysis, metagenomics, and the use of machine learning to understand community structure and species distribution. We welcome contributions that include:

  • Ecosystem monitoring using bioinformatics
  • Metagenomics in microbial ecology
  • Applications of machine learning in ecological studies
  • Environmental DNA as a tool for biodiversity assessment
  • Conservation genomics and species management
  • Metabarcoding approaches for large-scale biodiversity studies
  • Bioinformatic pipelines and tools for ecological genomics

This Collection supports and amplifies research related to SDG6: Clean Water and Sanitation, SDG 13: Climate Action, SDG 14: Life Below Water, and SDG 15: Life on Land.

All manuscripts submitted to this journal, including those submitted to collections and special issues, are assessed in line with our editorial policies and the journal’s peer-review process. Reviewers and editors are required to declare competing interests and can be excluded from the peer review process if a competing interest exists.

Publishing Model: Open Access

Deadline: Apr 30, 2027